, , ,

MMLV Rnase H minus First-Strand cDNA Synthesis Kit (50 reações x 20uL)


86 em estoque

MMLV Rnase H minus First-Strand cDNA Synthesis Kit (50 reações x 20uL)


86 em estoque

Consulte o prazo estimado e valor da entrega

Não sei meu CEP
MMLV RNAse H Minus First-Strand cDNA Synthesis Kit
incluindo dNTPs, anchored oligo(dT)20 primer e random hexamer primer
Código: 13-10504-005       
50 reações x 20µL
ARMAZENAR A -20oC.Descrição:
MMLV RNAse H Minus First-Strand cDNA Synthesis Kit é um sistema completo para síntese da primeira fita de moléculas de DNA complementar (cDNA) a partir de RNA mensageiro (mRNA) ou RNA total. Este sistema foi otimizado para a amplificação de cDNA de até aproximadamente 13 kb.
A enzima Transcriptase Reversa M-MLV RNAse Minus é uma versão modificada da enzima M-MLV apresentando mutações de ponto que reduzem a atividade de RNAse H e aumentam a estabilidade térmica.
Devido a reduzida atividade de RNAse H, não ocorre a degradação de moléculas de RNA durante a etapa de síntese da primeira fita de cDNA, resultando na síntese de uma grande quantidade de moléculas “full-length” de cDNA.
Devido a aumentada estabilidade térmica, a enzima Transcriptase Reversa M-MLV RNAse Minus pode ser utilizada na síntese de moléculas de cDNA em elevadas temperaturas (42 a 60oC), proporcionando um maior rendimento de moléculas de cDNA.
Dependendo da aplicação do cDNA, o usuário poderá escolher entre 2 tipos de primers:
Anchored oligo(dT)20 Primer é uma mistura de 12 primers, cada primer consistindo de uma sequência de 20 bases T seguidos por 2 bases adicionais representadas por VN, aonde V é dA, dC ou dG e N é dA, dC, dG ou dT. A “ancora” VN permite a hibridização dos primers somente na extremidade 3′ da cauda de poli-A de mRNA, promovendo uma síntese mais eficiente de moléculas “full-length” de cDNA.
É o método de escolha para geração de cDNA para experimentos de análise da expressão gênica por RT-qPCR devido a consistência dos resultados.
Random Hexamer Primer é uma mistura de primers de sequência randômica consistindo de uma sequência de 6 bases N, aonde N é dA, dC, dG ou dT. Devido a hibridização deste primer em várias sequências ao longo da molécula de RNA, teremos uma representação uniforme de todas as moléculas de RNA.
São utilizados na geração de cDNA a partir de RNAs que não possuem cauda poli-A.
Desta forma, a síntese do cDNA pode ser realizada a partir de mRNA poli-A+ ou RNA total.
Na próxima etapa, a reação de PCR é realizada utilizando primers específicos para os genes de interesse.
Neste caso, recomendamos o uso dos seguintes produtos:         Taq DNA Polimerase, Hot Start Taq DNA Polimerase,     SYBR Green qPCR Master Mix, EvaGreen qPCR Master Mix ou PROBE qPCR Master Mix
Componentes do Kit para 50 reações


Cód.. No. 13-10504-005      50 reações
50 µL Transcriptase Reversa M-MLV RNAse Minus 200 unidades / µL TAMPA VERMELHA
200 µL 5X Tampão de Reação First-Strand cDNA TAMPA TRANSPARENTE
50 µL Anchored oligo(dT)20 Primer 50 µM TAMPA AMARELA
50 µL Random Hexamer Primer 100 µM TAMPA VERDE

Nota Importante:Evite a contaminação por ribonucleases
A pureza e integridade do RNA é essencial para a síntese de moléculas “full-length” de cDNA. Como forma de prevenção para evitar a contaminação por ribonucleases, recomendamos o uso de materiais plásticos como microtubos e ponteiras com certificação RNAse-free.      Uso de água para biologia molecular com alto grau de pureza livre de RNAses. Uso de luvas durante a manipulação das amostras pois a pele humana é uma fonte de RNAses. Uso do inibidor de RNAse incluso no kit para proteger o RNA da atividade de RNAses.
Instruções para Uso
1. Descongelar, misturar e centrifugar rapidamente todos os componentes antes do uso. Manter os reagentes no gelo.
2. Adicionar os seguintes reagentes em um microtubo RNAse-free mantido no gelo:

Componentes Quantidade
1 pg a    5 µg de RNA total
1 pg a 0,5 µg de mRNA poli-A+
x  µL
Anchored oligo(dT)20 Primer
Random Hexamer Primer
2 µM  Primer gene-específico
1  µL
Água RNAse-free Completar o volume para 10 µL
3. Incubar os microtubos a 65oC durante 5 minutos.
4. Manter os microtubos no gelo por, pelo menos,                  1 minuto.
5. Preparar a seguinte mistura de síntese de cDNA, adicionando os componentes na seguinte ordem:
Componentes 1 reação 10 reações
5X Tampão de Reação First-Strand cDNA 4 µL 40 µL
10mM dNTP Mix 2 µL 20 µL
Transcriptase Reversa M-MLV RNAse Minus 200 unidades / µL 1 µL 10 µL
Água RNAse-free 3 µL 30 µL
VOLUME 10 µL 100 µL

6. Adicionar 10 µL da mistura de síntese de cDNA em cada microtubo contendo o RNA alvo e primer.
Volume total da reação de síntese de cDNA: 20 µL
7. Misturar a solução dos microtubos através de procedimento de pipetagem.
8. Incubar os microtubos de acordo com o primer utilizado para síntese do cDNA:
Anchored oligo(dT)20 Primer            60 minutos a 50oC*
Primer gene-específico                     60 minutos a 50oC
Random Hexamer Primer                 10 minutos a 25oC  seguido por 60 minutos a 50oC

* Para alvos de mRNA com alto conteúdo de bases GC, recomendamos a realização da reação de transcrição reversa incubando os microtubos durante 60 minutos a 55oC ou 60oC.
9. Incubar os microtubos por 5 minutos a 85oC para inativar a reação.
10. Manter os microtubos no gelo.
A mistura de síntese de cDNA pode ser armazenada a             -20oC ou utilizada imediatamente em reações de PCR e PCR em Tempo Real.
Para reações de PCR, utilizar 1 a 5 µL da mistura de síntese de cDNA como alvo.

Controle de Qualidade
Cada lote deste produto é avaliado em reações de PCR e qPCR em tempo real em um termociclador ABI 7500 Real-Time PCR System seguindo o protocolo descrito a seguir utilizando 5 µL do cDNA sintetizado pelo MMLV RNAse H Minus First-Strand cDNA Synthesis Kit a partir de 1 µg de RNA total purificado por RNAzol RT:
Reação de PCR
Protocolo realizado seguindo o manual do produto Taq DNA Polimerase utilizando os seguintes componentes da reação de PCR:


Componente da Reação de PCR Volume Concentração Final
Água para Biologia Molecular 33,75 µL
10X Tampão de Reação 15 mM de MgCl2 5 µL 1X
10 mM dNTP Mix 1 µL 0,2 mM
10 µM Primer Forward
GAPDH                                5’ CAAGGTCATCCATGACAACTTG 3’
2,5 µL 0,5 µM
10 µM Primer Reverse
GAPDH                                5’ GTCCACCACCCTGTTGCTGTAG 3’
2,5 µL 0,5 µM
Taq DNA Polimerase 5U/µL 0,25 µL 1,25 U
cDNA 5uL
Volume Total 50 uL

A reação de PCR foi realizada conforme as seguintes condições de ciclagem térmica:

Temp Tempo Ciclos
Denaturação Inicial 95oC 3 minutos
Desnaturação 95oC 30 segundos 35 ciclos
Pareamento 58oC 30 segundos
Extensão 72oC 45 segundos
Extensão Final 72oC 10 minutos

A análise da reação de PCR em um gel de agarose 2% deverá demonstrar a presença de uma forte banda correspondente a um produto de PCR de 496 pares de bases do gene GAPDH humano.

PCR Quantitativo em Tempo Real
Protocolo realizado seguindo o manual do produto PROBE qPCR Master Mix utilizando os seguintes componentes da reação de qPCR:
Componentes Volume Concentração Final
2X Tampão de Reação qPCR LOW ROX 12,5 µL 1X
20 µM Primer Direto
RNase P
0,5 µL 400 nM
20 µM Primer Reverso
RNase P
0,5 µL 400 nM
Sonda Fluorescente    RNase P
0,5 µL      200 nM
Hot Start Taq DNA Polimerase 0,5 µL
Água RNAse-free 3,5 µL
cDNA 5 µL
Volume Total 25 µL

A análise dos testes de qPCR em quadrupicata deverá demonstrar a detecção do gene RNase P humano com        Ct (cycle threshold) entre os ciclos 23 a 24 e desvio padrão de Ct < 0.2.

MMLV RNAse H Minus First-Strand cDNA Synthesis Kit
Produto para uso em pesquisas científicas

• Prazo para postagem: 5 dias úteis

• Disponibilidade: produto feito sob encomenda
• Pagamento no momento do pedido: 100% de sinal

Informações do Vendedor

  • Nome da Loja: 77 BIO
  • Vendedor: 77 BIO
  • Nenhuma avaliação encontrada ainda!
error: O conteúdo está protegido !!